Browse Markers

Export Markers Table as TSV
SpeciesMarker NameTypeForward PrimerReverse PrimerDescription
M. lewisii (LF10) x M. cardinalis (CE10)ML01_500ALPCCATACTGGTTCTGAAATTGCCAATCTCGCCAAGAAGTAGGAACLF10: 130 bp; CE10: 180 bp
M. lewisii (LF10) x M. cardinalis (CE10)ML01_1460ALPCATCTCTTGTGGCCAGCTTGTACAACAACCAAGTGTCCAATGCTALF10: 210 bp; CE10: 265 bp
M. lewisii (LF10) x M. cardinalis (CE10)ML01_2490ALPACGATGAACGGATTTATGGCTCCTCAAACCACATTATACAGCTGCLF10: 110 bp; CE10: 150 bp