Browse Markers

Export Markers Table as TSV
SpeciesMarker NameTypeForward PrimerReverse PrimerDescription
M. lewisii/cardinalis/parishiiMLCP1_3000ALPGTATCCACAAACCTGTGTCTCCAGCTGAAGTACCATCTCAGTATGGLF10: 265-bp; CE10: 310-bp; Mpar: 310-bp
M. lewisii/cardinalis/parishiiMLCP1_8000ALPAACATTCGCAAGTGAGGCCTAGATTCCAGCCCGAGATAGTGALF10: 155-bp; CE10: 200-bp; Mpar: 200-bp
M. lewisii/cardinalis/parishiiMLCP1_9000ALPCTGCTCTGTTATTCTCGCATCTAGCTTGTAGGTGTGTCTTTCACALF10: 245-bp; CE10: 300-bp; Mpar: 245-bp
M. lewisii/cardinalis/parishiiMLCP2_0550ALPCAACAGCTTTTCATTAAAACTTGTCCAAAGATTTAATGAATGATTTTGTGGTGCTALF10: 160-bp; CE10: 130-bp; Mpar: 130-bp
M. lewisii/cardinalis/parishiiMLCP2_0650ALPCTCAAGGAATATCAGCTGGTGTTAGGAGGAAAAAGTGCCTTCTTAGTLF10: 235-bp; CE10: 180-bp; Mpar: 235-bp
M. lewisii/cardinalis/parishiiMLCP2_0670ALPTCTATCTCATCGTTAGCAAGCCTCAATGGATGATGAATCTGGTGTTGCATLF10: 280-bp; CE10: 345-bp; Mpar: 345-bp
M. lewisii/cardinalis/parishiiMLCP2_0800ALPCTCTGTGCCTCATTCTTTGAGCTGAGAAGGATCCGACCCGTATCTLF10: 640-bp; CE10: 720-bp; Mpar: 770-bp
M. lewisii/cardinalis/parishiiMLCP2_0850ALPGTCTCGCTATTCATTTGTTGTCCTATGACTCGTCGTAGTGACTGTGGAALF10: 220-bp; CE10: 175-bp; Mpar: 175-bp
M. lewisii/cardinalis/parishiiMLCP2_0910ALPTACTCAAGAAAGCCGTCCAGATCATAATTAGCCGCTAATCGACCAGTACLF10: 1000-bp; CE10: 340-bp; Mpar: 340-bp
M. lewisii/cardinalis/parishiiMLCP2_0930ALPTTCTGCAGAACTGTAGCCAATCCCTGAAATGACTTGATTGAAGCCACALF10: 560-bp; CE10: 450-bp; Mpar: 480-bp
M. lewisii/cardinalis/parishiiMLCP2_1700ALPAAGCTCACATTGACTGACAAGGCTCTCGATCTCCTCTCAAGCCAACLF10: 460-bp; CE10: 500-bp; Mpar: 510-bp
M. lewisii/cardinalis/parishiiMLCP3_0150ALPAGAAGCGTCGTCACAACTCACGCACACTAGGAGATGGTGATGALF10: 240-bp; CE10: 275-bp; Mpar: 275-bp
M. lewisii/cardinalis/parishiiMLCP3_1000ALPCTGTATGAAGAGCTACCAAGTCTGGATATCTGCAAGTATGCAGAGLF10: 680-bp; CE10: 230-bp; Mpar: 230-bp
M. lewisii/cardinalis/parishiiMLCP3_7000ALPGTAGTGATGCTTCACCTGTCCAACTCGACATCTCCAGATTTGGALF10: 460-bp; CE10: 500-bp; Mpar: 500-bp
M. lewisii/cardinalis/parishiiMLCP3_8500ALPCCAGCATTGCATGACAGACCAAGGCTCTAACGAAGATGTATGGCLF10: 90-bp; CE10: 130-bp; Mpar: 90-bp
M. lewisii/cardinalis/parishiiMLCP4_0100ALPATTGCTGACAACTGGAGATAGCATTGGCCTCAGTGATTCTAAGCLF10: 170-bp; CE10: 220-bp; Mpar: 300-bp
M. lewisii/cardinalis/parishiiMLCP4_0500ALPGGATCCGTCCAAAATTTAACAAGGAAACACTCCACACAAATGYGCACLF10: 200-bp; CE10: 150-bp; Mpar: 150-bp
M. lewisii/cardinalis/parishiiMLCP4_0860ALPACTCAGGAGAAGGTGCAAGACCATGGATCAGTTTGTGGAGGCTGTALF10: 250-bp; CE10: 250-bp; Mpar: 450-bp
M. lewisii/cardinalis/parishiiMLCP5_0200ALPTGTCTGTGCAGCATTGTGTTACCTTAAGAATGCTCAAGGATCCACLF10: 190-bp; CE10: 240-bp; Mpar: 190-bp
M. lewisii/cardinalis/parishiiMLCP5_6000ALPCTCCTGATTCATCTTCTGACCACTTCTCCAGTTCTGTTGTCGAACLF10: 190-bp; CE10: 220-bp; Mpar: 190-bp
M. lewisii/cardinalis/parishiiMLCP5_8000ALPCAAGCCCATATTCTAATAGGAGAGTTTCACATGAATGTGTCGCATGLF10: 300-bp; CE10: 260-bp; Mpar: 260-bp
M. lewisii/cardinalis/parishiiMLCP6_1100ALPGGACCTTGATTACTGCAAGGCTATCTGCCACTGTCTTCGAAGCACLF10: 200-bp; CE10: 150-bp; Mpar: 150-bp
M. lewisii/cardinalis/parishiiMLCP6_3000ALPACGATGAACGGATTTATGGCTCCTCAAACCACATTATACAGCTGCLF10: 110-bp; CE10: 150-bp; Mpar: 110-bp
M. lewisii/cardinalis/parishiiMLCP6_5000ALPCCATACTGGTTCTGAAATTGCCAATCTCGCCAAGAAGTAGGAACLF10: 130-bp; CE10: 180-bp; Mpar: 180-bp
M. lewisii/cardinalis/parishiiMLCP6_7000ALPCCAGTGTTACGGTTGTGGGAACTYTTGAGCTCTTCATCGGCTGCLF10: 195-bp; CE10: 230-bp; Mpar: 230-bp
M. lewisii/cardinalis/parishiiMLCP6_7010ALPGCTCTTTCTGAGCAAGCTGTCAGACTGGTCGTATGACATGTCACLF10: 275-bp; CE10: 240-bp; Mpar: 275-bp
M. lewisii/cardinalis/parishiiMLCP6_7300ALPGACTCGCCCACCTACTTGCCACAGACCCGGTTTCCAGAGGTGLF10: 145-bp; CE10: 105-bp; Mpar: 130-bp
M. lewisii/cardinalis/parishiiMLCP6_8400ALPAGCCCATTCACTTCATCCTGTGATGTGTTCCAGGGTCTTCATCGALF10: 310-bp; CE10: 255-bp; Mpar: 255-bp
M. lewisii/cardinalis/parishiiMLCP6_8410ALPGGAAGTATGTATTGCGGGCATATGGGCCTCTACTTTTCCAGTATLF10: 630-bp; CE10: 555-bp; Mpar: 1200-bp
M. lewisii/cardinalis/parishiiMLCP6_8420ALPTCACAGTACAGACAGCAGTCCAAAAGCTGCGCTTGTGTCTGTAGLF10: 215-bp; CE10: 180-bp; Mpar: 215-bp
M. lewisii/cardinalis/parishiiMLCP7_0600ALPAAGTCATCTCTTACGATATCCACGTGTTGATAAAACCTACGCTTLF10: 400-bp; CE10: 400-bp; Mpar: 320-bp
M. lewisii/cardinalis/parishiiMLCP7_1500ALPGCAATCCACTCACAATTAACTCCGGTGATTCGATTTTGTTCGGAGLF10: 185-bp; CE10: 217-bp; Mpar: 217-bp
M. lewisii/cardinalis/parishiiMLCP7_3000ALPGGAATTTGGCTCATCTTGGCACGGAGAAACTGATGTAAGACCCALF10: 415-bp; CE10: 380-bp; Mpar: 380-bp
M. lewisii/cardinalis/parishiiMLCP7_8000ALPTCGTTTCGATTGGCGGAAACCAGGGATGATGATCAAGGTCCTGALF10: 160-bp; CE10: 100-bp; Mpar: 100-bp
M. lewisii/cardinalis/parishiiMLCP7_9000ALPGGATCCATCATCCAAGCTTGCATGTGTTCTGTGACATGCTAAGAALF10: 215-bp; CE10: 180-bp; Mpar: 215-bp
M. lewisii/cardinalis/parishiiMLCP8_0100ALPGGGCAATCATGTTTCCTTCAGCGTCAGCCTCGTCCTGAATGATALF10: 670-bp; CE10: 615-bp; Mpar: 615-bp
M. lewisii/cardinalis/parishiiMLCP8_0500ALPCGGTTCGTGTTCTTGTATGGAGCTCAACTGTCAAAGCTGCATALF10: 380-bp; CE10: 420-bp; Mpar: 380-bp
M. lewisii/cardinalis/parishiiMLCP8_1500ALPGGTTCATAGCACAAGTGTTGCAGCACTGCGTCACGGAATCAGALF10: 335-bp; CE10: 370-bp; Mpar: 335-bp
M. lewisii/cardinalis/parishiiMLCP8_2000ALPCATCTACATATGGTGTGGGAACATCCCAAACTACCGACACAACCLF10: 230-bp; CE10: 185-bp; Mpar: 230-bp
M. lewisii/cardinalis/parishiiMLCP8_8500ALPTACACCCACTTCTGTGTTAGGCGTTGGAGTGTATGGTTTAATGACCLF10: 270-bp; CE10: 230-bp; Mpar: 270-bp
M. lewisii/cardinalis/parishiiMLCP8_9000ALPAACGTGTCACATGGTTGGTATCGGACAACTTCTGGGAATGAATCLF10: 120-bp; CE10: 150-bp; Mpar: 150-bp