Browse Markers

Marker NameTypeForward PrimerReverse PrimerDescription
ML01_500ALPCCATACTGGTTCTGAAATTGCCAATCTCGCCAAGAAGTAGGAACLF10: 130 bp; CE10: 180 bp
ML01_1460ALPCATCTCTTGTGGCCAGCTTGTACAACAACCAAGTGTCCAATGCTALF10: 210 bp; CE10: 265 bp
ML01_2490ALPACGATGAACGGATTTATGGCTCCTCAAACCACATTATACAGCTGCLF10: 110 bp; CE10: 150 bp